Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14357B5
Clone ID IST14357B5
Vector VICTR74
Project tigm

Sequence tag IST14357B5HMF1
Sequence
ATATCTCATTTCTATTCAATTAATATTCCTGAGCAAATAACATTTTCCTTATTTGAAAAAAAATTGAAAAATTACAGTAT
GTATCTCTAGAACCATCCCCAAAACAAACAAAATCTGTCTCTTCCATTTATTTTTAACATTTATGATAATTGAACCTAGT
TAGAATAACTTTCTACTGTGTCCCAGCCTAACCTTTTAAGTACTAGATGTTCAAAATACTTTGTGTGAGAAATTAACTTT
CAAAATAGAAAATTCCCACACTAACTGTACATCTATCATTGCCTGCTACCAATATTTTCTATTTCTTGGGCCTANATTCC
TAATATTTCATATAATTCTATCATTTTTTATAANAGAATGTACTCGCTTAAGAGTTCATGTTATCTGATTATATGAAATA
TGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66651013..66651416 400
 
EST/CDNA Est Name
  BB627678.1


Sequence tag IST14357B5BBF1
Sequence
ATATCTCATTTCTATTCAATTAATATTCCTGAGCAAATAACATTTTCCTTATTTGAAAAAAAATTGAAAAATTACAGTAT
GTATCTCTAGAACCATCCCCAAAACAAACAAAATCTGTCTCTTCCATTTATTTTTAACATTTATGATAATTGAACCTAGT
TAGAATAACTTTCTACTGTGTCCCAGCCTAACCTTTTAAGTACTAGATGTTCAAAATACTTTGTGTGAGAAATTAACTTT
CAAAATAGAAAATTCCCACACTAACTGTACATCTATCATTGCCTGCTACCAATATTTTCTATTTCTTGGGCCTANATTCC
TAATATTTCATATAATTCNNNNNNNTTTTATAANAGAATGTACTCGCTTAANANTTCANGTNATCTGATTATATGANATA
TGTTANCNTGATAGCTATCAAGTNNGCGNATTTCTACAATGAANNNNTTTNNTATTATACTTCTACNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14357B5HMR1
Sequence
NNTGTTTAAAATATACATCCTAATGAATCCACTTAACTCCTGGTAAGAATTTCTTAAGTGTANAAAATTANCTCTTTGAG
AACCCCTTCAAACTGAAACTTTTTTTGTGTAATAACCAGAGTATTTTGTATTTCTTTAAGACATAATAGCTACAAGACAG
GGTGGACAGGAGCACCAACAGCTTTGGAATCTGGGAGATACNTACTGTCTTGGTCC
Sequence Type genomic DNA
Unitrap ID UNI14486

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66651416..66651628 207
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037876 (Jmjd1c) jumonji domain containing 1C Gene [Source:MGI Symbol;Acc:MGI:1918614]

 
Come back to gene ENSMUSG00000037876


For any suggestions or comments, please send an email to unitrap@crg.es