Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14923A3
Clone ID IST14923A3
Vector VICTR76
Project tigm

Sequence tag IST14923A3HMR1
Sequence
CTACTTCATTTGAATTTCTTCCTTTGAAGTAAGTTTCCTTTCGGGATGACCTCCTGGCCTTTGTGGATATGTGCAGTGAA
GTTCTGAGAAGGAGCTGTGGCTGTCACACATCTGCCTGATGCCTCCGGTAGGTACCCTCTTGAGGAACTTATTTCTGCAC
AACTGCTGTTGTCACTTCATTGGACATTTTCAAATCCATGGCTGTCTGACTCTGCTGANAATATGTCCTGCATGAATTGC
ATATGCTTCATCCTGTTC
Sequence Type genomic DNA
Unitrap ID UNI35189

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 51963845..51964101 253
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018417 (Myo1b) NM_010863 myosin IB Gene [Source:MGI (curated);Acc:Myo1b-002]

 
Come back to gene ENSMUSG00000018417


For any suggestions or comments, please send an email to unitrap@crg.es