Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST6789-NR
Clone ID PST6789-NR
Vector U3NeoSV1
Project escells

Sequence tag PST6789-NR
Sequence
TAAGGTGCTCAGGGTTCTTGGAAGCAAGGGTTATGGGAGTAGAGGTTCTTGGGGACTATGTTGTGGGAACTTGTGGAGGA
CTTAGCTGGGTAAGGGTTTTCCCAAGAGATGGGCAGTTATACTTGAAAATGCTTGTATATGGGATACTGTGTATCCAGAA
GAGTCCACGTAGAGACTGGAAAGTGGAAAGAATATGGAGTAGTACAGACTGAGTTAAAGTACACCACACAAAGCTCTTCA
GGTCTAGAAAGCGAACTTATGGGTTCTGCTGACACATG
Sequence Type genomic DNA
Unitrap ID UNI14752

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 13622066..13622343 276
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005575 (Ube2m) NM_145578 ubiquitin-conjugating enzyme E2M (UBC12 homolog, yeast) Gene [Source:MGI (curated);Acc:Ube2m-001]

 
Come back to gene ENSMUSG00000005575


For any suggestions or comments, please send an email to unitrap@crg.es