Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST6781-NR
Clone ID PST6781-NR
Vector U3NeoSV1
Project escells

Sequence tag PST6781-NR
Sequence
TTAGTTATTTTTGCATAAATTTTAAAAAACCATTTCCTTAAGATTGCTGTTTTATAAAAGTCATTATTACTGAAATGTGC
TATTTTTTTTTATCTTTTCTGCTTTTTGACTAATTCTAGTTTGCAACTATTTTGACTTATTTGTATTTTACCTTATTTTT
TCCTTTCTCTTTGTTCAGATCTTGTTAGAAAATTTTGATGAAGACATCGAAAAATGAAGACTAACTAAAATCCTCTGGGT
TTTTGGA
Sequence Type genomic DNA
Unitrap ID UNI15430

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 108489430..108489666 219
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028568 (Btf3l4) NM_027453 basic transcription factor 3-like 4 Gene [Source:MGI (curated);Acc:Btf3l4-001]

 
Come back to gene ENSMUSG00000028568


For any suggestions or comments, please send an email to unitrap@crg.es