Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AK0046
Clone ID AK0046
Vector pGT0lxr
Project sanger

Sequence tag AK0046
Sequence
GGGAAAGCAGCAGCACCAGATCCAAGATGGCGGCCAGCAGGAGGCTGATGAAG
Sequence Type mRNA
Unitrap ID UNI2763

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 27656144..27656196 53
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000064208 (AC160404.13) Putative uncharacterized protein Fragment [Source:UniProtKB/TrEMBL;Acc:Q3TW19]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 17201528..17201580 53
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038965 (Ube2l3) NM_009456 ubiquitin-conjugating enzyme E2L 3 Gene [Source:MGI (curated);Acc:Ube2l3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 74046519..74046571 53
 
EST/CDNA Est Name
  AK165620.1 - BC106149.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 22069603..22069655 53
 
EST/CDNA Est Name
  AK165620.1 - BC106149.1

 
Come back to gene AK165620.1 - BC106149.1


For any suggestions or comments, please send an email to unitrap@crg.es