Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14864H11
Clone ID IST14864H11
Vector VICTR76
Project tigm

Sequence tag IST14864H11BBF1
Sequence
AAATAAAAATAAAAACTAAGTCTTAAAGACTTCATCCTGCTGTTCTCACTTTCTCCCTTAGGAGATCTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 121253879..121253946 68
NO GENE  


Sequence tag IST14864H11HMR1
Sequence
ATTTATGTCTGTATGTGCTTGCTTGCACATGAATGCAGCGCCACAGAAGCCAGAAGACCCACTGTAGCTGGAGTTGCAGG
TGATCTGCCTGATGTGGGTGCTGGGACCTGAGCTCAGGTCCTTTGCAAGACTANCTAACTCTCCANCCCTNTGNNAANGC
ATCTTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI14300

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 121253943..121254116 162
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032536 (Trak1) NM_175114 trafficking protein, kinesin binding 1 Gene [Source:MGI Symbol;Acc:MGI:1914345]


Sequence tag IST14864H11HMF1
Sequence
AAATAAAAATAAAAACTAAGTCTTAAAGACTTCATCCTGCTGTTCTCACTTTCTCCCTTAGGAGATCTTCTCTATTCTCA
GATCTTAGCAGGCACATCTGCCCCTCAGTGAACCTGGACTAACCCTGTCTAATTAAACAGGCACACCCTTCCCACAAGTA
GGATCCAGTTCCCTGCTTAGCCTTTCTTCTTAGAAGTTAATTCCTCCAACACACAACAATCCACAATTGCAAATGCAAAG
CCCTGCACAGGTGGAGCCTGCCTGTGTTTTGTTCTCTGCCAGTGGGATTTCTTCAAAAGCCTCCATTGGCATCTTTCTCC
TTGGCTTGGTTCCCTGGGATGCCNAGACCGGAATTCTGTTTGTTCNNCTGGGGACCGGGTCTCCTGTAACCCANGCTGGC
CTTCANCTAATGGAATGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 121253529..121253946 408
 
EST/CDNA Est Name
  BB861417.1

 
Come back to gene BB861417.1


For any suggestions or comments, please send an email to unitrap@crg.es