Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST6687-NL
Clone ID PST6687-NL
Vector U3NeoSV1
Project escells

Sequence tag PST6687-NL
Sequence
CATGCCCCCAAATAAGTGAGGAGAATATCTTAATAATAAAGTTACCGGTTTCTTCTAGAACTCGCACTTGCATCGCTCTT
CAGTCTTAATGCCTTGTTTGATTTTTGGAGATACTTCAAATATACCGTAGCACCAACAAGTCTGGTAGTTAGCCCCGGAC
AGCAAGCACTGTTAGGGTTGAAACAGGCTGGTAAGTATTGTGGGGGAGGG
Sequence Type genomic DNA
Unitrap ID UNI15434

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 30456766..30456975 210
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029782 (Tmem209) NM_178625 transmembrane protein 209 Gene [Source:MGI (curated);Acc:Tmem209-004]

 
Come back to gene ENSMUSG00000029782


For any suggestions or comments, please send an email to unitrap@crg.es