Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14557C2
Clone ID IST14557C2
Vector VICTR74
Project tigm

Sequence tag IST14557C2HMF1
Sequence
ANGNGGTGGCACACACCTTTNANNCNNGCACTTGGCAGGCAGAGGCAGGCAGGCTGANGNCNGTGAATTCCAGGCCAGCC
TGGTCTACAGAGTTCCAGGACAGCCAAGGCTACACAAACACCAAAAGACAACCAACCAACCCACCAAGCTGCTACATGGC
TGTTGGGGGGGGGGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14557C2BBF1
Sequence
AGANGNGGTGGCACACACCTTTAATTCCAGCACTTGGCAGGCAGAGGCAGGCAGGCTGATGTCTGTGAATTCCAGGCCAG
CCTGGTCTACAGAGTTCCAGGACAGCCAAGGCTACACAAACACCAAAAGACAACCAACCAACCCACCAAGCTGCTACATG
GCTGTTGGGGGGGGGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 4602725..4602899 171
NO GENE  


Sequence tag IST14557C2HMR1
Sequence
CCTCCTGGCTGGCTTTTTGTTTCTTGTGACAGAATCTCATTATGTTGCCCATGCTGACCATGAACTTCTGACCTCCCTGC
CTCCACTTCCCGAGTGTTGGGGTTACATGCCTTTGCCACCATGCCTGGTTTGTGCAGTGCCAGGGGCANAAATTGGAGCC
TTGTGTTTGCTAAGCAAGCATGTTACCNNAAGAGCCCCTTACCCANAACGGTTCTGCCTGTGTTCGACCTTGCTGANTCT
GTGCCTCTAACTGCCCACCCCTCCCAGGGATTGCAGTGGCCGGCCTTGCCCANCCCTGCGTCCTTCCCTTCCCACCNANC
AGGCTGTGTGGGGGCTGCTTGGCCTGCTTGCCTCTGGCTGAGGCCCANGTGCANGCTTGCTCATGGCCCTATACCCTN
Sequence Type genomic DNA
Unitrap ID UNI15981

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 4602896..4603292 377
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000014303 (Glis2) NM_031184 GLIS family zinc finger 2 Gene [Source:MGI (curated);Acc:Glis2-001]

 
Come back to gene ENSMUSG00000014303


For any suggestions or comments, please send an email to unitrap@crg.es