Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14478C12
Clone ID IST14478C12
Vector VICTR74
Project tigm

Sequence tag IST14478C12BBF1
Sequence
AAGGGTCTTCTAGTTAAGGACAGGACCCACCTCTGCACATGCCAGGAAAGGAAATTTCACTCCATCTTTCTCTACTGAGC
GATGAAAAAAGACCCCAGTTCGGGCGATGCAATGTAACCTGAGATAATAGGTAAAGCCCCAAAGCACAGGTAGAAGAGTA
GTGAAAGCAACGCCTTCTGGGGGAGGAAGTGGGCAATGGGACTGGGAAAACAAAGATCAAAGTCGTCTTTATGGGTGACT
TTCAACCTTTTAACTAAATTCCCATCCTANGGAAGAATATCTCCTACTCGGTCGTCCTGCCCTANAAAAAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 91043408..91043723 312
NO GENE  


Sequence tag IST14478C12HMR1
Sequence
CCTTCTGATTCTATAGACACACCATTTTCTTTGCTCAGCTGTATCGACATGGAGATCGGTCACCAGTGAAGACATATCCC
AAGGACCCCTATCAGGAANAGAAATGGCCCCAGGGATTTGGTCAGCTAACCAAGGTGGGTCAAAAGCCAACCTGCAAGGT
CTCGGGATATGCTACGGAATGAATCACATCTGGAGCACAGAAACTGGGGCTCCTTANNCTACTANCTTCCCACATGGGTT
CTGATGGACCNNATGTCTNNTNNGNNGN
Sequence Type genomic DNA
Unitrap ID UNI35199

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 91043720..91043977 246
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002103 (Acp2) NM_007387 acid phosphatase 2, lysosomal Gene [Source:MGI (curated);Acc:Acp2-001]

 
Come back to gene ENSMUSG00000002103


For any suggestions or comments, please send an email to unitrap@crg.es