Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14260D4
Clone ID IST14260D4
Vector VICTR74
Project tigm

Sequence tag IST14260D4HMF1
Sequence
ATGCCTTATTCATTTATCACTCCAAATGGAAGTTCACATGACTTGTTATTCTGCATCTAATAACATTTAAGTGTGGAATA
AATTTCAATGTTTATAATTTTGATACATGTTTATTTACCCTGCTANAAACCTTTTCAAGGATAANAACCATATCTTATAT
TCCTTTAGTTTCTCACTATTTCTTAAATAATTTTCTGCCNTGAAATATCTAACANCCNTAAATGACTGATTTGTTTTGAG
GCANTCTCNCNTGGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4329807..4330061 239
NO GENE  


Sequence tag IST14260D4HMR1
Sequence
GCATCTAGGACTTTGTCAGCCTGTTTAGGGGTTTGTCATAAGTACCATCAGACTTAACCCAGAAAGCTTTAGGGAGGAGC
AAGTCTTACAGCTCTCTAAATTAAAAGAGATAGCAGTGTTAAGACAGAAGTTAGCATATTTTTCTGTGGAGATTCTGTGT
GTTTGTATGCCACACAGACAAAAATGGTCATATTATATAGCATTTGAAAAT
Sequence Type genomic DNA
Unitrap ID UNI24752

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4329600..4329810 211
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054611 (Fbxl11) NM_001001984 F-box and leucine-rich repeat protein 11 Gene [Source:MGI Symbol;Acc:MGI:1354736]


Sequence tag IST14260D4BBF1
Sequence
ATGCCTTATTCATTTATCACTCCAAATGGAAGTTCACATGACTTGTTATTCTGCATCTAATAACATTTAAGTGTGGAATA
AATTTCAATGTTTATAATTTTGATACATGTTTATTTACCCTGCTANAAACCTTTTCAAGGATAAGAACCATATCTTATAT
TCCTTTANTTTCTCACTATTTCTTAAATAATTTTCTGCCNTGAAATATCTAACAGCCNTAAATGACTGATTTGTTTTGAG
GCAGTCTCTCATGGCNNGTGANATTCCTAGACCCNNGANNANGGANGTGGCTCTTTNNNGATACTAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000054611


For any suggestions or comments, please send an email to unitrap@crg.es