Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13271C4
Clone ID IST13271C4
Vector VICTR74
Project tigm

Sequence tag IST13271C4HMF1
Sequence
CGACATTTCTTACAATATTCAAAGGCTCTCTTAAAAACTAAGTCTCTCTACCATTCCATGGTCTCTCAACTGTGGGCTCC
TGGTGAGACTCCCTCCGTTTATGTTTGGATN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 34911364..34911473 110
NO GENE  


Sequence tag IST13271C4BBF1
Sequence
NAGCCCTCCTTTGGAATAACTGTCTACTCGGGGAGCCTGAGTAAGCACGAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI31160

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28590342..28590395 54
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074243 (AC164532.4-202)  

 
Come back to gene ENSMUSG00000074243


For any suggestions or comments, please send an email to unitrap@crg.es