Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14845F9
Clone ID IST14845F9
Vector VICTR76
Project tigm

Sequence tag IST14845F9HMF1
Sequence
TGTGTATCACATAATACTTGTTCGTTTGAGAACATTACATGTCGGCGAAATGAAAACTAAACGCATGGAAAAAGTTTGAA
ATTAGTCCGCCTACGGGGTTCACTCGAGGTTGGCTACTTTCAGCTGCTAGTGTGTCTATTGTTTTCAAGTTAACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 53705853..53706006 154
 
EST/CDNA Est Name
  AA163341.1


Sequence tag IST14845F9HMR1
Sequence
NAGGGAGTATGTACTTCTTAATANGCATTATTTTCTTTTTTTCTCCTTAATTCCTCTGGATCCTTAGGGTGTGGAATGGT
GTCTTTCATATTCAGGGTAGGTCTTTTTCCTTTGGAAAGTCCTCACAGACAGATCCNGGTGCACCACATGGGTCTCCTGG
GGTGGAAATTCTAAATCCTGTCATGTTC
Sequence Type genomic DNA
Unitrap ID UNI20489

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 17760693..17760878 182
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037369 (Utx) NM_009483 ubiquitously transcribed tetratricopeptide repeat gene, X chromosome Gene [Source:MGI (curated);Acc:Utx-001]

 
Come back to gene ENSMUSG00000037369


For any suggestions or comments, please send an email to unitrap@crg.es