Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15056B2
Clone ID IST15056B2
Vector VICTR80
Project tigm

Sequence tag IST15056B2BBF1
Sequence
TGCCTAGTGCCTTTGGAGTCCAGAAGAGGGTACTGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 34937161..34937199 39
NO GENE  


Sequence tag IST15056B2HMR1
Sequence
GGCACATACATGGTGCACAGACATATATGCAGACAAACATTCATACACATAGAAAACCTCAGGGTGTTTTTCCATCTGTA
AATAGAGACACCTTACAGGGGTGCTGGACTTAACTGTGGTGGTTTTCTGATGCTGGACCTGCAGAATTTGTGCGCAGGTC
ACTCTTTGGGATCTCTTGTGTTTCTCCTTTTATTCTTTGCTAGGCTTAAGGAAAATTTGGGGGGTGGGGTTGAAGGGTGA
GGTCTGTGTCTCTGACATATATACAGGCTTTTAGCATCATTCTGGCCTGTGGCCGAGAGTCTGTGTCAGCTACCAGAAGG
CAGGATGGCGGGCGAGGGGTGAGGAGTGCTTACTTCCATACCGACCCTGATTGTNNCGGGTTTGGTTTTTTACTTANCTA
CATTTTCAATGGCAAGCAGTAGCTGTCATCTCAGTANCACATTGCANAATTGGTTGATGCTGTANTTNANGCNNCNGAGC
AATATANNTNNNTN
Sequence Type genomic DNA
Unitrap ID UNI29695

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 34937196..34937681 464
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029106 (Add1) NM_013457 adducin 1 (alpha) Gene [Source:MGI (curated);Acc:Add1-002]


Sequence tag IST15056B2HMF1
Sequence
TGCCTAGTGCCTTTGGAGTCCAGAAGAGGGTACTGGATCCCCTGGAGCTGGAGTCACAGATGACTGTGAGCCACCATGTG
GATGGATACTGAGAATCAAATCCAGGTCCTGCTGAATCACCTTCCCAGGCCTGCCACACACTAACTTTTGTCAGAGGACT
CAATAACAAATCACTGAACTCAGAACTGACTCAAGAGCACTAATTCCAAATGCCATGCTCATCTACTGTACTGAGGCCCA
GGCAGCCAGATTCAAATTCAGGAAGCACAAGCACACACTTCAGGCTTTCTGTCTGGTTCGGCAACATCTCTCCACTTCCT
GGGACATGACAGACTAAGAAAATAACTGTTCGGGTTTTTTGTTTGGTTGTTTGTTTGTTTGGGGGGTGGATTTTCNAAAG
AGGGTTTCTTTGTGTAACCNNGNNNGTCNNNNANTGNGCNTNNTAGACCNNGANGGNCTCNAACTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000029106


For any suggestions or comments, please send an email to unitrap@crg.es