Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14594B1
Clone ID IST14594B1
Vector VICTR74
Project tigm

Sequence tag IST14594B1HMF1
Sequence
AAATGAACAGTGGAACAGAACTCATTCAGAAGTTGGAAAAGAAAAGCTAAATTATAAAAGCTTTTCTAGGATTCCTTCTT
TTCTGTTCAATCCTAGACTTGTCCCTTATGTCTTTGTTTATTTTCTAAGCTGATGCTAATTCTAACCGTCTGTCTGAGAT
TTTATGGGAAAATTTCAACTTTTAAATATAAATTAAGGTTTCTTGTATTTAAGTACAACTTGAAGTATTTTTTATTTTTT
TGGGTTTTTTTTNGTTNGGTGTGTGTGTGTTNCA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 53956075..53956345 267
NO GENE  


Sequence tag IST14594B1HMR1
Sequence
ATTTNNATAAGCTTGACTTTGTGTGAGGAGAGAGATGCAATCTTGGAGTTCAGGGGTTTTGTCTGTGATTTTAACGCCAC
GATTCACACAGGCACTAAAGAAACTGTTTGTTCTGGTTCCTATAAACTCACTTAATGTTTTAATTCACCTGAACCAACAA
CCGAATGCCACAGGCCATTTCGAAACAACTTTCCCTCATCATTCAAGGTANCATGTGCTTTTCATAGTCTTTCAAATACT
GATCCCTGAAACAAAACCAAAAACATACCTTTGCCCTGTTTTCTATTCACTGTTCACCGCTGTAATGTANNNNNNCCCTC
TTTGGGGGGGGGGGGN
Sequence Type genomic DNA
Unitrap ID UNI683

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 53956342..53956676 317
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039191 (Rbpj) NM_009035 recombination signal binding protein for immunoglobulin kappa J region Gene [Source:MGI Symbol;Acc:MGI:96522]

 
Come back to gene ENSMUSG00000039191


For any suggestions or comments, please send an email to unitrap@crg.es