Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10894G9
Clone ID IST10894G9
Vector VICTR76
Project tigm

Sequence tag IST10894G9HMF1
Sequence
CTACCTAAGCTGCTCTGCATAAAGGCACCTCTCACCGCATTCCACTCCACTGNTCACACAGTAAATGGGTTATACATAAT
GGCACGTGTGCACTGGAGGTGTAGCTTANTGGCAGAGCACTGGCCTGGCACATTTGAGGTCCTTGGTTCGATCCCTAGCA
ATGTAAATTGATACTTGACCACACAAGTTTACTGAACTCACTGACAGCTTTTGAATGACCAGTGCTACCCGGGCAGTANT
GGCACACGCCTTTAATCCCAGCACTTGGGAGGCAGANGCAGGAGGATTTCTGAGTTCNAGGCCAACCTGGTCTACAGAGT
GAGTTCCAGGACAGACAGAGCTATNCNNANAAACTCTGTCTGAAAAAACAAAAACAAAACANCAACAACAAAAAACAGTG
CANTCTAGTCCTTCAAGCCCCCAAATACATGATATACCAAGAGTTCTATCATTTANTTTNAAGCCCTGNAGNNAAATATA
AAGGGTGACATGTATGGATCATTAAAANNAAATGANAATCTTTNNAATGTCTTAN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 56861227..56861759 490
 
EST/CDNA Est Name
  BY728735.1 - CF896873.1 - CA535754.1 - CD539421.1 - BG078279.2 - CJ062365.1 - CJ067532.1 - CJ160054.1 - AW319020.1 - BB861699.1 - CJ094037.1 - CJ071087.1 - CJ071042.1 - CJ055446.1 - CJ071083.1 - CJ069307.1 - BY015634.1 - BY066912.1 - BY017544.1 - BY309516


Sequence tag IST10894G9HMR1
Sequence
GGTAGAACCGAGGAAAATGTGTGCTGTGAGCCGGTGATTTGCCCTGCCGTGTTCTCAAGTCTTGAAGATTTGTTGGAAGA
TCTGGAGAGTCTCTGGAAGTGTATGTCCCAGATTACTGCCCTCAGGTGAACTTGTAATCACAATTAATAGAAGCATTGTC
CTGGGAAATGATGCAAGATGCTCTGCTTCCTGGCCCCTGGCCTGCAAGGTCTAAGGCGAATGATTTGCTTGGTCTGATAT
GCTGGGTTTAATTTTCTTGGTCTNTGTGATATCTTTTC
Sequence Type genomic DNA
Unitrap ID UNI7146

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 56860955..56861231 275
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038816 (Ctnnal1) NM_018761 catenin (cadherin associated protein), alpha-like 1 Gene [Source:MGI (curated);Acc:Ctnnal1-001]


Sequence tag IST10894G9BBF1
Sequence
CTACCTAAGCTGCTCTGCATAAAGGCACCTCTCACCGCATTCCACTCCACTGCTCACACAGTAAATGGGTTATACATAAT
GGCACGTGTGCACTGGAGGTGTAGCTTAGTGGCAGAGCACTGGCCTGGCACATTTGAGGTCCTTGGTTCGATCCCTAGCA
ATGTAAATTGATACTTGACCACACAAGTTTACTGAACTCACTGACAGCTTTTGAATGACCNGTGCTACCCGGGCAGTANT
GGCACACGCCTTTAATCCCAGCACTTGGGAGGCAGANGCAGGAGGATTTCTGAGTTCAAGGCCNACCTGGTCTACAGAGT
GAGTTCCAGGACAGACAGAGCTATACAGAGAAACTCTGTCTGAAAAAACAAAAACAAAACANCAACAACAAANAACAGTG
CAATCTAGTCCTTCAAGCCCCCAAATACATGATATACCAAGAGTTCTATCATTNAGTTTNAAGCCCTGANGTAAAATATA
ANNGGTGACATGTATGGNTCATTAAAACAAATGANAATCTTTTAN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 56861227..56861750 498
 
EST/CDNA Est Name
  BY728735.1 - CF896873.1 - CA535754.1 - CD539421.1 - BG078279.2 - CJ062365.1 - CJ067532.1 - CJ160054.1 - AW319020.1 - BB861699.1 - CJ094037.1 - CJ071087.1 - CJ071042.1 - CJ055446.1 - CJ071083.1 - CJ069307.1 - BY015634.1 - BY066912.1 - BY017544.1 - BY309516

 
Come back to gene BY728735.1 - CF896873.1 - CA535754.1 - CD539421.1 - BG078279.2 - CJ062365.1 - CJ067532.1 - CJ160054.1 - AW319020.1 - BB861699.1 - CJ094037.1 - CJ071087.1 - CJ071042.1 - CJ055446.1 - CJ071083.1 - CJ069307.1 - BY015634.1 - BY066912.1 - BY017544.1 - BY309516


For any suggestions or comments, please send an email to unitrap@crg.es