Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14999G8
Clone ID IST14999G8
Vector VICTR78
Project tigm

Sequence tag IST14999G8BBF1
Sequence
GCAGAACATTAGTAAACGACAGGGACTTATAGAAAATTAAGTCTATCTGCACCTTGATCTGTGTACTGCCAGCATGCAAA
ACTATGTGAAAATATATTTCTAGTATAACTTACCTAGTCTGTCGGTAAGTTACACTACCTACAGCAAGAATGCCTTTAAA
GAGTGAGAGGGGAAAGACACAAGTTAACAGCCTCTACGGGAAAAGGAAAGCAATACTAGGAACACACAGGGCTACTGGGC
TCCATATCTAGCATTTAAGAAATAAACATTCATAGACATGACCTACCTACAGGACATACTAGTGAACAGTCACAAGGAAT
ATGGGAGTGACGGCCACTTTCTGATGGGGTTAAGGCCACTCCATGAGATANAACCTATACCTGACACTGCTAAAGGGGCC
NGGAACCTGAGACTANTTANGTCATGGCCTANANCNAAACTAATTACNATTACTCTGTTAAAGAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 107720205..107720670 450
 
EST/CDNA Est Name
  BI735799.1 - CN533915.1 - BU513474.1 - BG296494.1 - CF735295.1 - CF163571.1 - BB642449.1 - BB635072.1 - BY731642.1 - CN536796.1 - BY261489.1 - CF734579.1 - CN673694.1 - CN460014.1 - BB840582.1 - BE305882.1 - CJ175454.1 - BY029288.1 - BY125091.1 - BY028492


Sequence tag IST14999G8HMF1
Sequence
GCAGAACATTAGTAAACGACAGGGACTTATAGAAAATTAAGTCTATCTGCACCTTGATCTGTGTACTGCCAGCATGCAAA
ACTATGTGAAAATATATTTCTAGTATAACTTACCTAGTCTGTCGGTAAGTTACACTACCTACAGCAAGAATGCCTTTAAA
GAGTGAGAGGGGAAAGACACAAGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 107720205..107720389 185
NO GENE  


Sequence tag IST14999G8HMR1
Sequence
NCNNTGCTGAACTATAATTCTTCANAAGTAATTGGATTGAAATACATTCAGATTTTGTTATGCCAGGAATATGCCTACCC
TCCCTACAGCATCCACTCAGCTTGGGGATGCGTACTCATCCTTCAAGACCATGCTTTTCCCTTCCCCTGTGAGGAAGCCT
CTGCTAAGCTTACTANAGTAGAAGTAGGTAGGTTTCCCTTCGTAACAGCTTACCNCGGTCTTTACAGTATATTTTACCTT
GTTTTTTCCCCTTGTANAATTGAACGCANAGGTTCCTATGGTGTATTTANAAATATACCAGTAGAGGCTGTTTATTGTTA
AACACTGTGAGTGTAGGTGGAGTTTTCCGAGTGGTACAGGAGTACCCTGANAAGGTTAN
Sequence Type genomic DNA
Unitrap ID UNI8225

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 107719829..107720202 360
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042590 (AC165281.2) NM_029665 Importin-11 (Imp11)(Ran-binding protein 11)(RanBP11) [Source:UniProtKB/Swiss-Prot;Acc:Q8K2V6]

 
Come back to gene ENSMUSG00000042590


For any suggestions or comments, please send an email to unitrap@crg.es