Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14623H3
Clone ID IST14623H3
Vector VICTR74
Project tigm

Sequence tag IST14623H3HMF1
Sequence
CAATCAGCAGTGAGACAACCTCTGATACAGTTCTAGATGCCTTTAAGTAGGTGAGGAAGGACGAATATTTACAAAATAGA
AAACCTGGTGATGAGCCACAGATAGCACCAGAGTTCTGCCCGCATTTAGTTCTGTGCCGGAACAGAACCAACAATTGAAA
ACACAGAAGTGCATCTTCTCACAACGTCCACNCNGTGATACCNNNGANNGNNNTTN
Sequence Type genomic DNA
Unitrap ID UNI34491

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 30728643..30728844 194
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059975 (Zfp74) NM_178384 zinc finger protein 72 Gene [Source:MGI (curated);Acc:Zfp74-003]

 
Come back to gene ENSMUSG00000059975


For any suggestions or comments, please send an email to unitrap@crg.es