Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST8598-NR
Clone ID PST8598-NR
Vector U3NeoSV1
Project escells

Sequence tag PST8598-NR
Sequence
GCTTCCTCACCTGCTCTGGGACACCTAACTCAAGAAGACCTCCCTTCTCCCCCTGCCGGCCCAATTATGGCAGAGAACGA
TGTGGACGATGAGCTCTTGGACTACGAAGACGACGAGGTGGAGACAGCCGCTGGGGCAGATGGGACCGAGGCTCCCGCCA
AGAAAGACGTCAAGGGCTCCTACGTCTCCATCCACAGCTCCGGCTTCCGAGATTTTCTACTCAAGCCAGAGCTGCTCCGG
GCCATCGTTGACTGTGGCCTTTGAGCATCCATCA
Sequence Type genomic DNA
Unitrap ID UNI12760

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35380120..35380391 264
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019432 (Bat1a) NM_019693 HLA-B-associated transcript 1A Gene [Source:MGI Symbol;Acc:MGI:99240]

 
Come back to gene ENSMUSG00000019432


For any suggestions or comments, please send an email to unitrap@crg.es