Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14496G8
Clone ID IST14496G8
Vector VICTR74
Project tigm

Sequence tag IST14496G8HMF1
Sequence
CTAGAGAGCCACTCAGCCACTGAGCACAGTTCCTGTTCTTGCAGAAGACCTAGATTTGGTTCCTAGAACCCACATCAGGT
AGCTCAAACCACAGCCTCTTCGGGGCTCCACCAACACTATAGTCATGTATACCAACTCACACATGTAATTAAACTTTAAA
AAAAGAAAACACCCTACTTCATAAACAAGACCCCATGCAACCCACAGATATTTATTGAATGCTGAGTTCCAGAACTAAAA
TGGGTGACAATGCAGGCTATAGGTTGGCCAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 56822824..56823093 270
NO GENE  


Sequence tag IST14496G8BBF1
Sequence
CTANAGAGCCNCTCAGCCACTGAGCACAGTTCCTGTTCTTGCAGAAGACCTAGATTTGGTTCCTAGAACCCACATCAGGT
AGCTCAAACCACAGCCTCTTCGGGGCTCCACCAACACTATAGTCATGTATACCAACTCACACATGTAATTAAACTTTAAA
AAAAGAAAACACCCTACTTCATAAACAAGACCCCATGCAACCCACAGATATTTATTGAATGCTGAGTTCCAGAACTAAAA
TGGGTGACAATGCAGGCTATAGGTTGGCCNCTCTCCTCTCCGGGGCAGCATAGAAGGGATGGACAGAGCCCAAGCAGGAG
ANGANGGTGCNNNTACAACAGGAGCCCCAAGGCTGGGACAGGAGCAAGCCTTGAATTCACTGAACCACAGAGCTTCNCAG
ANATTACNGCTGCTGTCATCTAACCCCTANAGGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 56822659..56823093 407
NO GENE  


Sequence tag IST14496G8HMR1
Sequence
NTANCACCTTCTGGTTTTGTTTGTACTTAGGACAGCCTTCAGGACAGGTTTTCTACCCTGTGGGTTCCACAGTCCAGTTG
GCACCAAGCATCTCACCCTGCTGAGCCATCTCACCAGCCCTGTTTGTTTTTGAGGTAGTCCCACGTATCATGTAGTCATC
TTGACCGCCTGATCCTCTGCCTCTACCTCCCCAGTGCTGAAGGGGTGCAGGTGCAGGTGTGTGTGCCACACTACATGTGG
TTTCTGTGGTGCTGGGGATGGACATGCNNCCGTGTGCCCTGCTTANAGAGTGGGTGGATTTTAGGTN
Sequence Type genomic DNA
Unitrap ID UNI6726

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 56823091..56823395 297
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002372 (Ranbp3) NM_027933 RAN binding protein 3 Gene [Source:MGI Symbol;Acc:MGI:1919060]

 
Come back to gene ENSMUSG00000002372


For any suggestions or comments, please send an email to unitrap@crg.es