Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11405F2
Clone ID IST11405F2
Vector VICTR76
Project tigm

Sequence tag IST11405F2BBF1
Sequence
GCTACAGTGTACTTACATATAATAAATAAATGTTTA
Sequence Type genomic DNA
Unitrap ID UNI31470 UNI35206

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 15584039..15584074 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022674 (Ube2v2) NM_023585 ubiquitin-conjugating enzyme E2 variant 2 Gene [Source:MGI (curated);Acc:Ube2v2-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55205775..55205810 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022179 (4931414P19Rik) NM_028890 RIKEN cDNA 4931414P19 gene Gene [Source:MGI Symbol;Acc:MGI:1921609]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 116777778..116777813 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 70984885..70984920 36
NO GENE  


Sequence tag IST11405F2HMR1
Sequence
AGCNATCCTCANANACTCCANAAGAGGGCATCAGATTTCGTTACGGATGGTTGTGAGCCACCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000022179


For any suggestions or comments, please send an email to unitrap@crg.es