Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13656C3
Clone ID IST13656C3
Vector VICTR74
Project tigm

Sequence tag IST13656C3BBF1
Sequence
TTCGGTACAGATGGGCAGATCTGTCGAGGTCNATCGACGGTATCGATTANTCCAATTTANCACANACATGATACACAGAC
ATACATTCAGACACTCATACATATAAATTAAAAATAAATAAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI31820

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 71736007..71736072 64
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052852 (Reep1) NP_848723 receptor accessory protein 1 Gene [Source:MGI (curated);Acc:Reep1-001]


Sequence tag IST13656C3HMF2
Sequence
TTCGGTACAGATGGGCAGATCTGTCCCCAGGTGCTGCTGAGGGGTTTGGAATGTGTGGGCCAGGAGTAGTCTAGGTCTGT
GTAGAGAAGGGTGGATAAGTGGCTTTCCGAACTTAGATCACGAGAGCCTTCTTGAAGTGCAGCCACATGCAGACATGAAN
AGCATCTGCAGATTCAAGAAACAGGAAAGGGACAAACATGGAACCTAGGAGCCAGCGCCTCAGCACACCGGAGCTCATTA
ACACTGGGTCCTAACAGTGTGGTGCTCACAGAGTCC
Sequence Type genomic DNA
Unitrap ID UNI2261

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 100237757..100238029 271
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001552 (Jup) NM_010593 junction plakoglobin Gene [Source:MGI (curated);Acc:Jup-001]

 
Come back to gene ENSMUSG00000001552


For any suggestions or comments, please send an email to unitrap@crg.es