Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST8545-NR
Clone ID PST8545-NR
Vector U3NeoSV1
Project escells

Sequence tag PST8545-NR
Sequence
GTAAGTTCTCCGTGGTCTCTCCTATCAGGCTGCGAAGGCCGGGGTCTCTCTGTCCACATGGACATGGCCTCTGTCACCAA
GGCCATGGCAGCCCCAGAGTCTGGGCTCGAAGTCCGGGACCGCATG
Sequence Type genomic DNA
Unitrap ID UNI15145

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 69821494..69821619 126
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020888 (Dvl2) NM_007888 dishevelled 2, dsh homolog (Drosophila) Gene [Source:MGI (curated);Acc:Dvl2-001]

 
Come back to gene ENSMUSG00000020888


For any suggestions or comments, please send an email to unitrap@crg.es