Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12108G2
Clone ID IST12108G2
Vector VICTR76
Project tigm

Sequence tag IST12108G2BBF1
Sequence
AAACAAAACAAAACTCCAAATAAATAATGTTTCTTCTANTANGGGAAGTANAAAAATAAAGAATGTAAAAAAAGGGCTGG
AGAGATGGCTCAGCGGTTAAGAGCACTGGCTGTTCTTCCAGGGGTCCTGAGTTCAATTCCCAGCAACCACATGGTGGCTC
ACAACCAC
Sequence Type genomic DNA
Unitrap ID UNI14032

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 77551691..77551857 161
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037857 (Nufip2) NM_001024205 nuclear fragile X mental retardation protein interacting protein 2 Gene [Source:MGI (curated);Acc:Nufip2-001]

 
Come back to gene ENSMUSG00000037857


For any suggestions or comments, please send an email to unitrap@crg.es