Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13217D7
Clone ID IST13217D7
Vector VICTR74
Project tigm

Sequence tag IST13217D7HMR1
Sequence
TTCTAATCTTGCTGACTACCTCCCAGGTATTGGGACTTGTAACATATACCACCATGCCCACCTTTAAAATGAATTTGTTC
CTTGGCTTGGTGGTTGTTTGTTTAGTGGGGGACAGGAGTGGACATCAAACCCCGGATCTTTTGCATATTANCAAGCACTT
TACCACCTAGCTGCACCCTTCTGCAGCCCTTCTCTTTTTCTTTTTGACAACCATATCCGAGGATTATAGATAGATATGTA
TTACTATCCAGCTAATGTCTAAGTTCAAGTGTANATCATCTAAAATTCTGGGTTTTTTTTTTTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI2416

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 43228230..43228541 308
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038214 (AK122525) NM_199028 BEN domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:2677212]


Sequence tag IST13217D7HMF1
Sequence
AGAAGTTCAAGGCCATCCTAAGCTACATGACACCATATTTAAAAAGAAAGGAAGACAGAACCAGTAAACACCAAAATAAC
TGTGGAATGAAAGAAGTCAGATTATTCAATGTCACCTATGTANATTCTAGAAAATACATCCAGTGTTGCTAGAAAGCANA
TCANTGGGTGACTGGGATGGGAGGGAGAGAGGGAAAGAANANACCCACANACTGACNGACNCAGACCACACCCTCAGGTT
ATGCACTTCACATACTATTAACGGACCTCANTTACNANTTAATANTGATTTTTGACNNNNGTTTAATTTGAACCNNGANC
TTGNNGGANTATATGTATTTGANAGTGTAATTAANCNNNNNTACTGATTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000038214


For any suggestions or comments, please send an email to unitrap@crg.es