Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11886B11
Clone ID IST11886B11
Vector VICTR76
Project tigm

Sequence tag IST11886B11BBF1
Sequence
ATTCCAAGTGTCAGCCAAGAGCAAAACCTGTANAAACCCTGGCCATGTGGCCTTCTCANANATGAGGCTGAGCCAGGACA
CTTTTCCAATCTTTGGGGTTCCTGGCACCTTCAAATGCAGGTGGGTGAGCAGGGTTATAACTAGGGCATGCTTACTANAN
CAGCTTAAACTAAACAAATCAAACATCTTTTGTCTCATTTTCTTTTGTTACAGTGTGTCATGTANATTGGACTTGTCATA
TACTCATTATGCCTCTAAGGCTGACCTTTGACCCCTGGTCCTCCTGGCTCCTTCATCNTGTANGTGTGAACCACTAAACC
CTTAACATGGGCAAATANGTTTCACATATANAAAGGCTTCATGGACAATANTGGTCTNACTCNCATCANTTTAANATAGT
AACAGATCTGTC
Sequence Type genomic DNA
Unitrap ID UNI31190

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 3844611..3845021 381
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000082848 (AC133523.2)  


Sequence tag IST11886B11HMF2
Sequence
CCTGGCATCCAACTAGCAGTCAGGAACAACAATTCTANGTGTTACAGGAGACTTTTCTTTCCCTGANCCAGTGGGAGGGG
CTGAGGAGTGAGGAGCCAGTGGTCTGGGCAGCTGCCCCAACCAGTTTTCCTGGTTGTACCTGGCAGGCTGGGGCTCCGCA
NAAACCTTGTCTATTGCTTTTCCTGTTGGACTGANTCTGACACCCCTATCTCAGCGACCTTANNGGGGGTAGGGGGAGGT
CCTGGCTGTGTGCTANATTCCTGCTGGTGAAAGCCACATTCAAATATGCTCNATGGCTGATGACTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30318943..30319249 291
 
EST/CDNA Est Name
  AA289560.1

 
Come back to gene AA289560.1


For any suggestions or comments, please send an email to unitrap@crg.es