Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14457H11
Clone ID IST14457H11
Vector VICTR74
Project tigm

Sequence tag IST14457H11HMF1
Sequence
CAGGTAGCAAGCTCTTACACACTGAGCCATATTGCAAGCTCAATTTCGAAGTATTTTTGTCTATTTTTAATGCATGTATT
AAGTGTAAAGAAAAATAAGCCCTAGCATTTATGGGAAGCATTCTGAGCAAGAAAGGCAGGATTCTGGGGAACTTTGTTTG
CAAAAATCAAATAGGGTTTGTTTCTGATGGATCTGAAGGCTATCTACATAAATTTAATATGTATATTAAACTCAGATATA
TGAGTCTGAGATGTAATTTAGTGAGTAGAGTACTTACTCTGCAATCACAAGGTCCTGAATTTGACCCCCACCACCTCATA
AAATTGTTCCGGTGGCACACATCTGAAATTGCTGCCCGGTGGAGGTTC
Sequence Type genomic DNA
Unitrap ID UNI14364

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 71193112..71193478 367
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027010 (Slc25a12) NM_172436 solute carrier family 25 (mitochondrial carrier, Aralar), member 12 Gene [Source:MGI (curated);Acc:Slc25a12-001]


Sequence tag IST14457H11BBF1
Sequence
CAGGTAGCAAGCTCTTACACACTGAGCCATATTGCAAGCTCAATTTCGAAGTATTTTTGTCTATTTTTAATGCATGTATT
AAGTGTAAAGAAAAATAAGCCCTAGCATTTATGGGAAGCATTCTGAGCAAGAAAGGCAGGATTCTGGGGAACTTTGTTTG
CAAAAATCAAATAGGGTTTGTTTCTGATGGATCTGAAGGCTATCTACATAAATTTAATATGTATATTAAACTCAGATATA
TGAGTCTGAGATGTAATTTAGTGAGTAGAGTACTTACTCTGCAATCACAAGGTCCTGAATTTGACCCCCACCACCTCATA
AAATTGTTCCGGTGGCACACATCTGAAATTGCTGCCCGGTGGAGGTTGACGCAGGAATGTCACAAGCTTGAGGGTAGACT
GAANTANGCACAAGACCTTGCTGCAAAAAAGCCTANAACCGAGCTGGTNANTTGGCNCAGCAAATANAGGTACTTCCTGC
NNAGCCNANNCNCCTGGGTCCTGTCCATGCNCCTANCTNNTACNCACNATANACNNANNATN
Sequence Type genomic DNA
Unitrap ID UNI14364

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 71192946..71193478 490
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027010 (Slc25a12) NM_172436 solute carrier family 25 (mitochondrial carrier, Aralar), member 12 Gene [Source:MGI (curated);Acc:Slc25a12-001]


Sequence tag IST14457H11HMR1
Sequence
CCTGACTACACAAGCCTAATGGCCTCAATTCAAACCCCAGAACCTGCGTGGAGGTGGAAAGAGAGAAACAACATCACAAT
AACAAACTAATGTTTCAAAAGATTGCAAAACTTAAAACACATATATGTTTTCTCTGTCCATTATAGCTAGACCTACTATC
AGCTAGGGCAATGTAATTCCTAACAGAGCAGGAAAGAACTCAAGGCATTGTAAGTAATGAACTAATGCTGGCTCTTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 71193475..71193712 238
 
EST/CDNA Est Name
  BY133510.1 - BB844075.1 - BY293213.1 - BY133915.1 - BY143297.1 - BY125651.1 - BY000651.1 - BY120256.1 - BY128567.1 - BY125293.1 - CX221765.1

 
Come back to gene BY133510.1 - BB844075.1 - BY293213.1 - BY133915.1 - BY143297.1 - BY125651.1 - BY000651.1 - BY120256.1 - BY128567.1 - BY125293.1 - CX221765.1


For any suggestions or comments, please send an email to unitrap@crg.es