Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AK0005
Clone ID AK0005
Vector pGT0lxr
Project sanger

Sequence tag AK0005
Sequence
AAGGCCACAAGTCTCAGATGAAGATGGAAGGCGTTCAGACGGTGAGGAGGAGCAAGACCAGAAGTCAGAATCTGCAAGAG
GCAGTGACAGTGAAGATGAAGTTTTACGACTGAAGCGCAAGAACGCGATTCCATCGGATTCCGAAGCAGACAGCGACACC
GAGGTGCCCAAAGATAATAATGGAACCATGGATCTGTTCGGAGGTGCAGATGACATATCTTCAGGGAGTGATGGAGAAGA
TAAGCCCCCAACTCCAGGACAGCCTGTGGATGAAAATGGCTTGCCCCAGGATCAGCAGGAGGAAGAGCCCATACCTGAGA
CCAGAATAGAAGTGGAGATCCCCAAAGTAAACACGGACTTGGGCAATGACTTATATTTTGTTAAACTGCCCAACTTCCTC
AGTGTAGAGCCCAGGCCTTTTGATCCTCAGTATTATGAAGATGAATTTGAAGATGAGGAGATGCTGGATGAAGAGGGGAG
AACCAGGTTAAAATTGAAG
Sequence Type mRNA
Unitrap ID UNI2774

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 75293733..75298379 148
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042487 (Leo1) NM_001039522 Leo1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2685031]

 
Come back to gene ENSMUSG00000042487


For any suggestions or comments, please send an email to unitrap@crg.es