Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11322F6
Clone ID IST11322F6
Vector VICTR76
Project tigm

Sequence tag IST11322F6HMR1
Sequence
NAGTTCATTTGAGTCTGAGCAGTATGAACTTAAAACAAACAAAAAATACTTTATACTCC
Sequence Type genomic DNA
Unitrap ID UNI21463

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 11733638..11733694 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020182 (Ddc) NM_016672 dopa decarboxylase Gene [Source:MGI (curated);Acc:Ddc-001]


Sequence tag IST11322F6BBF1
Sequence
TTATGAACTTTCTTTTAGCTGCTATCCGAATGTTGAATTTGAATCCTGAAGTAATTANAAGTTGGGGACTTCAAGGTTTA
TTAGGTCGTAGTGGTGCAGAGTTTTTTTTTTTTTTTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 11733694..11733808 113
NO GENE  

 
Come back to gene ENSMUSG00000020182


For any suggestions or comments, please send an email to unitrap@crg.es