Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14618A10
Clone ID IST14618A10
Vector VICTR74
Project tigm

Sequence tag IST14618A10HMR1
Sequence
AGCTGAGCTGTGACTGCCTCCATCCCAGGCCCCAGGTCATGTGGTCTGCCTTGCTTTTCCGTTTCCCACTGGTTCCTGAT
CTGTGAGTTTGTAGCCTGTATTCTCATCTAGGAATCCTGGAACCGGTGCTTCCTCCTTATCANATTGTAAGGCCCATGTG
AGTTTTTCCTGCNTCTN
Sequence Type genomic DNA
Unitrap ID UNI35212

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 121898156..121898331 172
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066235 (C85492) NM_153540 Uncharacterized glycosyltransferase AGO61 Precursor (EC 2.4.-.-) [Source:UniProtKB/Swiss-Prot;Acc:Q8BW41]


Sequence tag IST14618A10HMF2
Sequence
AGCTTGCTGANAGCCNGGNANGGCANCANATATCNGNNNNNANCNNGGTGCCCACCTGAGGCTGCAACAGCTGACCACCT
TGGGCCGGGGCCTTAAACAACANAAACTTCCTCACAGTACTGGAGGTTAAACGTCCANCGTTAATGATCACAGTCAGGGA
TTTGACACAGCTCANTCTGTCCTGCAGGTGAAATGTGAAAAGTCCTCATCTGTAATTTCTGGCGACTGTACCGTGTANAC
AANAGTGGGACGGCTGGCCTCACACCACCTGGTGGAATCAGGTGTGCATTGGCTCCTAANCTCTGGCCCAAAGANCTGCA
NGANTGTCANANACAGCTGTTCACCTGTCGATCCCCCAANAGCANGGCTCCTGGCAAGGTTCTACACAAACATTACAGCA
ATTTANCTTTATGGCANTATCCTTTNTTTGCAACGGAAGTACTTTANCCTAAACACAGCATGTGTTTATTANTGAACTNT
GGACNCTTTGGGTANAGCNNGGNNGTCCCNTGGCTTTGANCCCTCNGGNNTTTTTNCTTTNGGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14618A10BBF1
Sequence
CTCTCCTTTTCTAGCCCTGAGTTTCCCTCTCTACATGCCTCCCCTGTGGCTGGCGTTGACCAGTTTGCCCCCTCATCTGT
CACCTGTGGTCTCTTTCCCAGAAAGAGTTTTGTAACAACAGAAGAGATCCCAGTTGCATACACTTTACATTGTGTGCACA
AAACAGATGCAGAACTCTTGGACCATTGTAATGTAATGCTCAGGCCCCTGGTCTTTAGAACTGAACCTACACAGTCACTC
CCTGCAAGACTCGAGTGCAGACCCAGGACAGTGAAACGAGTCACTAAAGGTCACACTAAAGGTGCCTGCTGCCAGGCTTC
ACGACCCAAGTTTTATATCTGGAACCCACATGGTGGAAGGAGAGAAGCCATTACCAAAAGCTGGCCTCTGACTTCNACAT
ACATGCTGTAGCACATACATATATCCNACCNCCTACTTAATAAATACNTGTCATANNTTTATTCATTACCNCTACTGNTA
TATTTTNNGTTTTGTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 12545623..12546119 473
NO GENE  

 
Come back to gene ENSMUSG00000066235


For any suggestions or comments, please send an email to unitrap@crg.es