Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15055C11
Clone ID IST15055C11
Vector VICTR80
Project tigm

Sequence tag IST15055C11BBF1
Sequence
ACTAAATTCCTAAGTTCCTTGGAGTCCCGGGACCAAGATGGCGACCGCTGCTGCTGTGGCTTAGGCCGCCTCCCCAGCCG
GGTGGGCACCTGTCCTCCGGTCCGGAAGGTGGCCGGCTGTCCCCGGCCCACAAAGGGTGCTGCCTCAGCGCCTCTGTGCT
TCCGCCTGTTCCAGAAGCTGTCAGGTTCTCTGGCGCACCCTCTCACCTGTTCAGACTAATTTCCTAANTTCNGCGGGTCC
CGGACCAAGATGGCNACCGCTGCTGCTGTGGCTTANGTCNCCTCCCCANCCGGGCGGGCACCTGTCCTCCGGTCCNNANN
GNGGCNGGNTGTCCNNGGCCNANANANGGTGCTGCNTCANCGCCTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST15055C11HMR1
Sequence
AGTCTGCTTAGGTGAGAGTCTGTACCACCTGGGAACTGCCAAAGCAACACAGTGTCTGAGAAAGGTCCTGTTTTGGGCCA
TCTTCTTCGGCCAGGAGGAGGTCCAAATACAAGATATCTGCGCACCTTCCCTGTAAGAGAGCTTGCCAGCAGAGAGTGCT
CTGAGCACTGAAACTCAGAGGAGAGAATCTGTCTCCCAGGTCTGCTGATAGACGGTAACAGAATCACCAGAAGAACAATC
TCTAAACAGAGTCC
Sequence Type genomic DNA
Unitrap ID UNI33719 UNI33720 UNI33721

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 16286380..16286632 253
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048834 (Vstm2a) NM_145967 V-set and transmembrane domain containing 2A Gene [Source:MGI (curated);Acc:Vstm2a-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 14003920..14004172 253
 
EST/CDNA Est Name
  CA748406.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 59208560..59208812 253
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 16370349..16370601 253
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 65105158..65105410 253
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 35442849..35443101 253
 
EST/CDNA Est Name
  AA003113.1 - AA472676.1 - W63990.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 59275613..59275865 253
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 35979740..35979992 253
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 64049073..64049325 253
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079500 (AC114408.18) Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q8CC18]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 127650613..127650865 253
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051900 (Abca16) ATP-binding cassette, sub-family A (ABC1), member 16 Gene [Source:MGI (curated);Acc:Abca16-001]

 
Come back to gene ENSMUSG00000051900


For any suggestions or comments, please send an email to unitrap@crg.es