Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14159A6
Clone ID IST14159A6
Vector VICTR74
Project tigm

Sequence tag IST14159A6BBF1
Sequence
AAGTGTACACTACCAAACCTAGTTCGTGAAATGCTGGGGATTGAATTTAGGGCCCCATTTTTGTTAGTACTTTATCAACA
GCTACATGTCCAGCTTCAGATCTGTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108369127..108369231 105
NO GENE  


Sequence tag IST14159A6HMR1
Sequence
NNACTTGTTGCAGTATCTTTTATTTGCCTGATAATCGTGAAGGCTTACTGCCTCTGTCTGCTAACCTAGGCCCAGACCTG
GAAGTGTCTAGCCTCCATACAATCTAATCTAGGCCTANACTGCTCGGCCC
Sequence Type genomic DNA
Unitrap ID UNI15792

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108369004..108369130 125
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029270 (2900024C23Rik) NM_026062 RIKEN cDNA 2900024C23 gene Gene [Source:MGI Symbol;Acc:MGI:1914516]

 
Come back to gene ENSMUSG00000029270


For any suggestions or comments, please send an email to unitrap@crg.es