Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10665H11
Clone ID IST10665H11
Vector VICTR76
Project tigm

Sequence tag IST10665H11BBF1
Sequence
ACCCCACAAAAACTGACCGCACTCAAGGGACAGACGATGCATGGTTTAACTTTATCTCTAACTTCTGCTTTATTGACAAA
TCTAATATAATACAAATAACATTATGTACTGCTAAAACATAACGAATTAATAAAAACCCCGTTAGCACTCGCTTTAGTGG
CAGGACGGAAGCCTCTGGGTACTCACCTCTATAAAGGAAAACCTGCCTACAACATAAGATGCCGGGGTTATGCTTCTAGG
GCCTGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 134375893..134376141 249
 
EST/CDNA Est Name
  AI427435.1 - BU922522.1 - BE333850.1


Sequence tag IST10665H11HMF2
Sequence
GCCCTAACAGCCACCGCACAACTGCACAAGGCAGTAAGCAGTCACCAGAGTGCCTGGAATCCTGCCTACCTAGGCATTTT
TCTTAAAGGTGAAGGCCACAGGAGCACAAGGTGGGTGACCTGCTTGCAAAACCCTTGTGCCCCACTGTAGCTCCTCCCAA
CCTCAATGTCTTCATCAGAATTCAGGAGTAGCAGGTAGGAGTGCAGTCACTCTGATCCGTTGGCTTGGGCTGGAACCTAN
GTGTGANAGCTTGGA
Sequence Type genomic DNA
Unitrap ID UNI5356

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 124894773..124895026 250
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049327 (Setd8) NM_030241 SET domain containing (lysine methyltransferase) 8 Gene [Source:MGI (curated);Acc:Setd8-001]

 
Come back to gene ENSMUSG00000049327


For any suggestions or comments, please send an email to unitrap@crg.es