Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13069E1
Clone ID IST13069E1
Vector VICTR76
Project tigm

Sequence tag IST13069E1BBF1
Sequence
GTATTTACAGGANAGAGTATTCTCAGTACGGCTGGAAAGACAGCTTACTGGTCAAGAGCACTTGAATTCCATTCCCAGAA
CCCACGTCAGAAGGTTCATAACTCCCTGAAACTCCNGCTCTCGGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 100763455..100763582 124
NO GENE  


Sequence tag IST13069E1HMF2
Sequence
CTAGATACATTGCATGTGTTCCTTGTGGGCACAGAGGGGCTCTGGATACAGGTGCCTATGAACTCCTCTGAGGCCAGGGA
GGGGTANTTCTGGAAGGATAGGGCTTANGGACAGCTCCCATCCTCTGTTCCCTCTGAAAGCCTCCTTTAGTCTCTCCGTT
CACCCTGCCTTCCANACAGAGGAGCTGAACCGAGAAGTGGA
Sequence Type genomic DNA
Unitrap ID UNI35217

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 100126344..100126543 194
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053654 (Krt42) NM_212483 keratin 42 Gene [Source:MGI (curated);Acc:Krt42-001]

 
Come back to gene ENSMUSG00000053654


For any suggestions or comments, please send an email to unitrap@crg.es