Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14862C6
Clone ID IST14862C6
Vector VICTR76
Project tigm

Sequence tag IST14862C6HMR1
Sequence
CTAACAAGTTCTCTGGACCAACCACAGATCTAGACACTGCTGCANAGCTGTGGACACTTTTTCTCCTGTGCCAGTTCACC
TCCCAGGGCTCCCAGCCCTGACCAGTCAGTCGGCTTTCTTTCGGCTTTCGGTCTNANAAGCACCGACAGTCCTGGGGGAG
CAGGCN
Sequence Type genomic DNA
Unitrap ID UNI30528

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 79458798..79458962 159
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017639 (Rab11fip4) NM_175543 RAB11 family interacting protein 4 (class II) Gene [Source:MGI (curated);Acc:Rab11fip4-001]


Sequence tag IST14862C6HMF1
Sequence
GTTAGGATTCTGATTCTCAGATCTACCCAGGACTGGGGAGAGGAGGGAGTGAATGTGGCCTGCCATCTGCACTTAGCCAG
CTGACTCTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 79458713..79458802 90
NO GENE  

 
Come back to gene ENSMUSG00000017639


For any suggestions or comments, please send an email to unitrap@crg.es