Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11118B5
Clone ID IST11118B5
Vector VICTR76
Project tigm

Sequence tag IST11118B5BBF1
Sequence
GTGCTATGGGGAAAAGCTAGGACTTGTGCAGCTATGGGTATGGCCAAGAGAACACTCCATTTTCTCCTTTAACTTTGTAC
AAGCTAGCCCTATTTAGGATCT
Sequence Type genomic DNA
Unitrap ID UNI30904

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 11723914..11724014 101
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020182 (Ddc) NM_016672 dopa decarboxylase Gene [Source:MGI (curated);Acc:Ddc-001]


Sequence tag IST11118B5HMF1
Sequence
GTGCTATGGGGAAAAGCTAGGACTTGTGCANCTATGGGTATGGA
Sequence Type genomic DNA
Unitrap ID UNI30904

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 11723972..11724014 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020182 (Ddc) NM_016672 dopa decarboxylase Gene [Source:MGI (curated);Acc:Ddc-001]

 
Come back to gene ENSMUSG00000020182


For any suggestions or comments, please send an email to unitrap@crg.es