Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13517F6
Clone ID IST13517F6
Vector VICTR74
Project tigm

Sequence tag IST13517F6HMR1
Sequence
TTATGTCCGTGCATGTGAGGCCNGAGACATCTATCTCAGTGGAGTCTGTTTTTTCCTCCCATCTTTACTCAGTCCCAGGA
AGGGGGGAAATTGAACTCC
Sequence Type genomic DNA
Unitrap ID UNI35218

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 28686968..28687064 95
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024224 (Gm749) NP_001030043 gene model 749, (NCBI) Gene [Source:MGI Symbol;Acc:MGI:2685595]

 
Come back to gene ENSMUSG00000024224


For any suggestions or comments, please send an email to unitrap@crg.es