Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14450G9
Clone ID IST14450G9
Vector VICTR74
Project tigm

Sequence tag IST14450G9HMF1
Sequence
CANGTNCNGNNNGCCTGGNNAGAGGGAAGGGGCAGTGTTAGTACACTGGTGCCCCGGAAGCAAGCTCTGAAGCCTGGGCA
TCTCGTGCTGAGTCTTGCCACTCTTGGTAATCGGTTTCATGACCTTTGAGAAGCTCCCTAAATCCATTGGTTTCTAAGTC
TGGAAATGGGAACTAATAATTGTGTTTTTGCCCAGTAGTTGTGAACCAGAAGTGAGATAAGGTGTAACCAGTGCTTGGCT
Sequence Type genomic DNA
Unitrap ID UNI8152

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 60655145..60655371 223
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034485 (Uaca) NM_028283 uveal autoantigen with coiled-coil domains and ankyrin repeats Gene [Source:MGI Symbol;Acc:MGI:1919815]


Sequence tag IST14450G9HMR1
Sequence
TTCCCAACACAGAAGGGCTGCATGAGGTGAAGGCCAGTCTGGGCNNNAAGGAAGTTTCTAGCTAGCTGANGCTATCTCAA
AANCAAACAAAATCAAGTAAATAATAAATCCCACCCCTGCTGTGAAGGACTCACTGGANAAGAACAGATGGGAGAAGAGG
GAGGTCTCCCCATAGCCTGGTCCTGGGGGAACAGCCTCTGCATCCCTAACATTGCTTTCTAATTTGAGGTGGACAGTGAT
ACCCCTCCCTCCAGGCCCTTGGGTGGCCCTGANTTGCCCTGACCTATGCNNNCNNATTTCAACANCNNAGAACTTGTTGT
ANAANCCTGCGCCTCANCCTCATCAAGGCCTGNTNNACTGCNNNCCTTGGANAGATCCCTACNCNGTGGTACCCTTTGCT
CGGGTCACCAAAGCCNCTGTCCNCCTCTGACNACACCCTGGGCTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000034485


For any suggestions or comments, please send an email to unitrap@crg.es