Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST8069-NR
Clone ID PST8069-NR
Vector U3NeoSV1
Project escells

Sequence tag PST8069-NR
Sequence
CTTCGTCTACCTTTTAAGAGAGAAATGCAGACCTATTGAGATAGATGGTGGGCCTCTCTGGAGAGGATCTGCCTGCATAA
AAGTGGACGCTGCTGCTTTCCTTTCTTCTTTGTAAATATCGTGGGGGGATGAAGCCCACTGTTAGGCAAGAATAGGTGTC
GCCCCCCTTCCCCAGGCAATGGTGAGCTTGAAGGAAGTGGGAGAAGGGGGGCGCCGATGCTCTCCGGAGTGTGTCCTCTG
CCTTACTGGCTGCCCCTGGGAAAANCCTTTATCCANC
Sequence Type genomic DNA
Unitrap ID UNI10487

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 32007243..32007511 248
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039262 (5830434P21Rik) NM_172661 RIKEN cDNA 5830434P21 gene Gene [Source:MGI Symbol;Acc:MGI:1923304]

 
Come back to gene ENSMUSG00000039262


For any suggestions or comments, please send an email to unitrap@crg.es