Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13422G5
Clone ID IST13422G5
Vector VICTR74
Project tigm

Sequence tag IST13422G5HMF2
Sequence
CGGAGTTTCGAGTCTTTCTCCAGGGTTCCTGCAGAAGGCATTCTCTGAGGGTTGCCTCCATTGCCTATGCGGGGGCTGCG
GAGGTTTATTTGGGCTTGGTGAAGAGACTTGAGAGACTTGGGTGAATAAGGTGAGGCTTTTCCAGCTCTTCTGTCTATCA
ATGCATGCTGAGC
Sequence Type genomic DNA
Unitrap ID UNI35220

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 83501702..83501873 172
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035427 (CN716893) NM_001033492 Novel protein containing a MAGE family domain (MCG1035418) (Expressed sequence CN716893) [Source:UniProtKB/TrEMBL;Acc:A2A9R3]


Sequence tag IST13422G5BBF1
Sequence
GANACCCCTGCCCAGGGACCNCCGACCCA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000035427


For any suggestions or comments, please send an email to unitrap@crg.es