Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST8037-NR
Clone ID PST8037-NR
Vector U3NeoSV1
Project escells

Sequence tag PST8037-NR
Sequence
GGAGCACGCTCTGAACTAGCATGGTTTACACAGTGAGGTCCAGGCTAGTGGAAGTTACATAGCGAGAATGTACCCCACAA
AGGGAAGCTGCCTACTGAGCATATGGGAGCCCTGGGTTCCATCCTCAACTCCATAAAACCATGTTTAGAACTCGTCTCCT
TCCCTTGCCTGCCTTGGGCAAGAGTCAGAAAGCTTTACTAAATCCCTGGAAAGGGACAGAGGGCCTGGCCCTAGAGGCTC
CTAGCATG
Sequence Type genomic DNA
Unitrap ID UNI15467

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 97624779..97625026 248
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031788 (Kifc3) NP_034761 kinesin family member C3 Gene [Source:MGI Symbol;Acc:MGI:109202]

 
Come back to gene ENSMUSG00000031788


For any suggestions or comments, please send an email to unitrap@crg.es