Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10749E8
Clone ID IST10749E8
Vector VICTR76
Project tigm

Sequence tag IST10749E8HMF1
Sequence
CTACCACATTTTCAAAGAGAGGTATTCAGGGACCTTAACACATTTCATGCCTTACTGCAAGACCTGTGGCCCTACCTGTA
CTTGTTCCTTCATATACTGTACTGCTGCTAAAGGAAGCACCAAGATCCATTCATATAATCCTTGAGAGCAGCACAGGCGT
GCAGGGCGGGATAAAGCTGAAATCACCTCCACCACCTCCCACCCACCCGCGGGGCTTTGGAGATTGTGTGTCTAGGATTC
TCCAGATTAAAAGCCANCGGTATTTGAGAATGGAAGTGAAATGAATTCTAAAAGCAAGAAAGCAGAAGGAATATCTGCAT
AAATAGCTCCCAAATTTATCTTCTGCATTGAAATACTTGCATACCGCTGCCANCACTTGCAAGGCAGGGGCAAATGGATC
TCTGANAGTTCAAGGGTANCCTGGTCTACAGAGCTAGTCCCANGACAGCCNANGCTGCACAGAGAGACTGTATCTGGATA
AAACANAACN

Sequence Type genomic DNA
Unitrap ID UNI13061

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84847113..84847601 473
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073633 (Fbxo36) NM_025386 F-box protein 36 Gene [Source:MGI (curated);Acc:Fbxo36-001]


Sequence tag IST10749E8BBF1
Sequence
AAAAGAAAAAAAGAAAAGAAAAGAAAAAAGAAAAACACCAGGCCACTAAGCATAAAACACTCATTCTAATGACATAGTGT
GCAACTGTAAGGAGGACCACAGCCTGGCAGGATTAGCCCTGTGGAGCCCCTATGCTGTGGAACATATGCTCTACCCCCAG
TGTGGCCGTCCTCTGCTCTCGGACACACACACCAAGGCACACTGCAAAGGGAAATCCAATTAGTTAGCAGCAGATCTGT

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 27936615..27936852 238
 
EST/CDNA Est Name
  BG230287.1 - BE979906.1 - BE688798.1 - AI835178.1 - AI666342.1 - AW123169.1 - BE957410.1 - BE952887.1

 
Come back to gene BG230287.1 - BE979906.1 - BE688798.1 - AI835178.1 - AI666342.1 - AW123169.1 - BE957410.1 - BE952887.1


For any suggestions or comments, please send an email to unitrap@crg.es