Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14840F7
Clone ID IST14840F7
Vector VICTR76
Project tigm

Sequence tag IST14840F7HMF1
Sequence
CTTACCTTCTGTCAGCCTGAGAATAAGAGTGGGATCTAGCCCCAGACGTTCATAGGAGGAGCTGCCTGCGTCAGCGAAAA
AAGCTAGCTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 93012987..93013077 91
NO GENE  


Sequence tag IST14840F7BBF1
Sequence
CTTACCTTCTGTCAGCCTGAGAATAAGAGTGGGATCTAGCCCCAGACGTTCATAGGAGGAGCTGCCTGCGTCAGCGAAAA
AAGCTAGCTGGCCAAGGTGTGAGCGACTCTTCATTCGGGACGAAAATGTTGTCTTCTGGTAGATTTTCATGCTGTGGTTT
TTCATTCTCTCCTGCCCAAGATGCGAAAAGCATGAAAGGAATTTTAATGCACCAAAGTATTATACTGTTATAACGGTGCT
CAGATGTAAACAGCAAAGACCTTCGGCCTTAGGCAGTTCCGGAGCTCGCCCGGGAAGAAATGTACCCANCATCCTTTGCT
TTNTTACNCNGAGACNNGGATNACCTTGCAAAGGCGGGCCTTATACAAACTATCTNANANNCNNANACNNGANAATGCCT
N
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14840F7HMR1
Sequence
GTAAGTGTGAGGGTTCGAAGAGGTTTTACCCTCTACAGACTCCTGTGTTCGAATGGCTCAGAGGTAGGTAGTGTTACTAT
TAGGAGGTGTGGCCTTTATAGAGGACATTTGTCACTGTGGGGCGAGCTTTGTCATCTTAAACGTTTAAACTATGCCCAGT
GTGAAACAAATCCAGCCTCGTCCTGGCTTCCTGCTAATCAAGGTGGANAACTCTCTGCTCCTCCAGTGTCATGTCTGCTA
CAGGCTGCCATGCTTCCTGCCNTGATGACGGTGGACNAAACCTCTGAAACTGTAAGCTGGGCCTAATTCAATATTANCCT
CTGTAAGAGTTGTTGTGGTCNTAGTGTCTCCTCACAGCAATTGAAATCCTN
Sequence Type genomic DNA
Unitrap ID UNI35222

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 93013073..93013442 360
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036168 (Ccdc38) NM_175488 coiled-coil domain containing 38 Gene [Source:MGI (curated);Acc:Ccdc38-001]

 
Come back to gene ENSMUSG00000036168


For any suggestions or comments, please send an email to unitrap@crg.es