Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST7941-NR
Clone ID PST7941-NR
Vector U3NeoSV1
Project escells

Sequence tag PST7941-NR
Sequence
TAAGCAGTCACTTACGTCACCCCAGGGTAGACCTGGGCCTTGGCAGATCGCTGAAGAGCAGTGTCTTTTCTCATCTTTTT
AGCAAGTGGGTTCTAGAAAGAGCAAAGGCCTTGGCCCATATCCTGGAAGGTGAGAAGCAAGCCTTCAAAGGCAGAATGCT
TAGTGTAGGTTTTAGTCTCTGTGATGAAGCCAGAAATTAGATGTGAGCTCTGACTTCTCAGTTACCTGTCTCCAAGATCT
CTCAGGCATCCTGTGGTGCTCTGTGGTTACTGTGGCCTTGC
Sequence Type genomic DNA
Unitrap ID UNI154

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 150784509..150784788 280
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000010755 (Cars) NM_013742 cysteinyl-tRNA synthetase Gene [Source:MGI (curated);Acc:Cars-002]

 
Come back to gene ENSMUSG00000010755


For any suggestions or comments, please send an email to unitrap@crg.es