Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13663D11
Clone ID IST13663D11
Vector VICTR74
Project tigm

Sequence tag IST13663D11HMR1
Sequence
GGACAGCCNGGGCTACACAGAGAAACCCTGTCTCGAAAATCGAAAAACAAACAAACAAAGAATCTATTTTCTAAGAGTTT
TCTTGCAAGCACTCAGAATTTCCACTCAGTTCCGTTCGTGAACCGAGTTTCAGGAGTAGCTTATGTTGATGGTCACAGAG
TAAAGATGGAGATAGATATTACTATTGCCTAATTGGGTGCATTTTTATTGTAAAGCTGAGACATCTTGATGACCTTGATC
CTCCTTCCACCTCACAGCTTTTAGGATTACAAGCGTGTGCCATCNTATAAACCTANGCNCTGAAGTGTGTACTTCCNGTT
TTCCTATGCNACTGTGGGAGGTGGN
Sequence Type genomic DNA
Unitrap ID UNI12755

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108548341..108548684 332
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000064145 (Arih2) NM_011790 ariadne homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1344361]


Sequence tag IST13663D11BBF1
Sequence
GTCCTAGAGCTCACTCTGTANACNAGGCTGGCCTCGAACTCANAAATCTGCCTGCCTCTGCCTCCCAAGTGCTGGGATTA
AAGGCATAGATTCGTACNACCTCAGTTTCTTCACAGAACTGTTCTTGGAATGTATTCTCCTGTTCTCGCAAGTGTAGCTT
AACAGTTTCCTCATACTGTTTGTTGTTACTCAATTAAATGTGTAAACTATCCACATTTGGCTGGTCCTTGTGATCTTACT
CATATGGTTTCTCTTAACCCTCAGANTATAAATTATTCAGAGTATNNNNGCTCTGAATAAANTTGNTTATTTAATGAAAC
TTNTGTCNCNCNCATTTATCANGTCNNNNNGACTCTANANTGNTAAACATGCTACNATACCCAGTCACCTCATNTTACAA
ANGCNACCTGGTTTTTCTNNNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000064145


For any suggestions or comments, please send an email to unitrap@crg.es