Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14725A7
Clone ID IST14725A7
Vector VICTR76
Project tigm

Sequence tag IST14725A7HMR1
Sequence
ATACCAAGAGAATGTTGTGAATGCCAGCTCTGCTAATTCAATTACCAACTACCTACTCTGGGAGTGGAGCGGTCANAAGA
CAGGGCGATCCCCATTCCACCGTAGGGCGCTTGCTCGCTGTGTTCCACAGCAGTTGTGGGGAAGTTCATTTCGGGACTCA
TTAAAATGCCTGAGACCTGATACCACTTGGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 118771855..118772046 190
NO GENE  


Sequence tag IST14725A7HMF1
Sequence
TATCCCATCTCAAAGGGCGTGTGAATTCAGAGAATTCAGAAGGGCCNANCANCTAANTCTCAGGCCCANTCATGTTTACC
CACTTGCCGTCAGCTGTGCTTAGGTAACGTGATACATANAAGTGGCCCAGGGAAATGACAGGGAGCANAATGTCGGCTGA
CAGGGAAACANGANTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14725A7BBF1
Sequence
GTATCCCATCTCAAAGGGCGTGTGAATTCAGAGAATTCAGAAGGGCCCAGCAGCTAAGTCTCAGGCCCAGTCATGTTTAC
CCACTTGCCGTCAGCTGTGCTTAGGTAACGTGATACATAAAAGTGGCCCAGGGAAATGACAGGGAGCAGAATGTCGGCTG
ACAGGGAAACAGGAGTTAACAGGAAACACATGGTCTTGACACAAATGAACCTGCGCTGCTTCACCCGTCAGCTCTGGGCT
CGTTTCAAGTCAACTTCCCCCAAGGGCTGCATTGAGGGAGACTCCAAGCANGGCTCCTGANTGGTGCAGAGTTANTTCAA
GTTTCNGCTTACCTGTCTCTCGGACTATGCACCANANGCNTGGAGTCNNGCNNATTTNNATGACCTTCTCTGN
Sequence Type genomic DNA
Unitrap ID UNI25019

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 118772043..118772434 366
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039115 (Itga9) NM_133721 integrin alpha 9 Gene [Source:MGI Symbol;Acc:MGI:104756]

 
Come back to gene ENSMUSG00000039115


For any suggestions or comments, please send an email to unitrap@crg.es