Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14885C5
Clone ID IST14885C5
Vector VICTR76
Project tigm

Sequence tag IST14885C5HMF1
Sequence
CCCCCAATCATTAAGGATGCACAAGGGTTATCAGTTCTGCAACAGCGGCGTTTCAAACACCGAGACACTGAGCAAAAAGA
GGAAGAGTGCTTGGTTGGGCTCCAGCACGGAGGTGTGCCGGCACCGCGGGCTGAGCGGGGAGGAAATGACGAGCCAGAAA
GGGGTGGTAACGGCGCCGGCCCGGGAGCCCCGGTGGCGGGCCGAGAGGAGGGGCGCGGCAGGCGCGCCAACGGCCCCGGG
GTGGGTCNTGGNANGCNNCNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 48548229..48548484 250
 
EST/CDNA Est Name
  AW519403.1 - BY079417.1 - BY344905.1 - BY344895.1 - BY206151.1 - BY222131.1 - BY213644.1 - BY215257.1 - BY233161.1 - BY126183.1 - BY184701.1 - BY774721.1 - BY343980.1 - BY345164.1 - BY292474.1 - BY182386.1 - W71894.1 - BB847300.1 - BY183907.1 - BY013053.1


Sequence tag IST14885C5HMR1
Sequence
GGGGCACACATCTCGCAGTTCCTATTATCCCTGTCTCCTCCCTTGATCTTTTCTCCCTTGGATGCTCTCTGGTTTTGTTT
TCCTTTAATCTCTCCACTCAATAGCTCGGCCCACTCGTGTCTCTTTTTTCTAATACACCTTGAAATCCCGCGCGAACGTT
TTCTCAACTGATGTTTTAAAACTTACNCNTGCTTANATTTTCTTTCCCCCTTCGGGGGACAGGAAGTCNTN
Sequence Type genomic DNA
Unitrap ID UNI543

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 48548005..48548232 222
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023994 (Nfya) NM_010913 nuclear transcription factor-Y alpha Gene [Source:MGI Symbol;Acc:MGI:97316]

 
Come back to gene ENSMUSG00000023994


For any suggestions or comments, please send an email to unitrap@crg.es