Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12720E6
Clone ID IST12720E6
Vector VICTR76
Project tigm

Sequence tag IST12720E6BBF1
Sequence
AGCTAACAAGAGCCACTTTGTCCTACTCTGAGAAGAGACTTAGGGGTCAGCCTGGCCTCTTANAANANGCTTTNGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12720E6HMF1
Sequence
AGCTAACAAGAGCCACTTTGTCCTACTCTGAGAAGAGACTTAGGGGTCA
Sequence Type genomic DNA
Unitrap ID UNI5091

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 20132448..20132496 49
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044066 (Cep68) NM_172260 centrosomal protein 68 Gene [Source:MGI (curated);Acc:Cep68-001]

 
Come back to gene ENSMUSG00000044066


For any suggestions or comments, please send an email to unitrap@crg.es