Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14761G1
Clone ID IST14761G1
Vector VICTR76
Project tigm

Sequence tag IST14761G1HMF1
Sequence
TACTAAGATACATGCCAACATCTATTTAATGATGTCCTCTGTTACTTAACATGATGACTTCCAGGTTCCAACCACTTTCC
TGAAGACAACATGACTGCATTCTTCTTTATGGATGAATAAAACCCCTTTGCTTATATAGCACATTTGAGTTATCCAGTTG
TCTTATTTAGTCACTGTTCTACTGCTATGAAGAGACACTATGACCAAGCCAAGTTATAAAAGAAAGCATTTAATCAGGGC
TTGCTTACAATATCAGAGGGTGAGCCCATCACCACCATGGTGATACAGTTAACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108281674..108281966 293
 
EST/CDNA Est Name
  BE987278.1 - BF714023.1 - BE447306.1 - BF464895.1 - BG228559.1 - AW048537.1 - AW046259.1 - AI845193.1 - BE984435.1 - BE984980.1 - BF721825.1 - AI846809.1 - BE982131.1 - BE982104.1 - CA479070.1


Sequence tag IST14761G1HMR1
Sequence
CNATCTGGGAATCAAGCTCTCAAATACACNANNNNCTCTCTTTCTCCCCTCTTCCTCTCTCCCAGCCTCTTCCTCCAAAC
AAACAGGCATGGTGGCATAGGCCTTTAATTGCAGCATTTGGGAGGCAGAGACAGGTACATCTCTGTGATTTGGAGCCAGC
CTGGTCTATATAGTTCCAAGACACCTAGAGCTACATAAAATGACTATCTTAAAACAAACAAAAAACCAACCCCCCCCCCN
AAAT
Sequence Type genomic DNA
Unitrap ID UNI27871

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108281426..108281666 227
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000011831 (Evi5) NM_007964 ecotropic viral integration site 5 Gene [Source:MGI (curated);Acc:Evi5-001]

 
Come back to gene ENSMUSG00000011831


For any suggestions or comments, please send an email to unitrap@crg.es