Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11336A8
Clone ID IST11336A8
Vector VICTR76
Project tigm

Sequence tag IST11336A8BBF1
Sequence
CTGCATATATAGATACACACACACACACACACATGCATATATCCCTTCCTGANATCCGTGTGTACTCTATATGGCTTTAC
NGTGGTTGGTTAGGGTTGAGGGTATATATAACTCAGTGATGANGACGTGCTGGCTGTGTGAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI16684

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 135080372..135080517 140
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028165 (Cisd2) NM_025902 CDGSH iron sulfur domain 2 Gene [Source:MGI (curated);Acc:Cisd2-001]

 
Come back to gene ENSMUSG00000028165


For any suggestions or comments, please send an email to unitrap@crg.es