Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST7488-NR
Clone ID PST7488-NR
Vector U3NeoSV1
Project escells

Sequence tag PST7488-NR
Sequence
CTGCAGCCATCTGATGACCAGGTCGTGTTGTAAAATGGGGCTTGATTAAAAAACGTAGAGAAACACATG
Sequence Type genomic DNA
Unitrap ID UNI3426

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 116380676..116380744 69
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028690 (Mmachc) NP_080238 methylmalonic aciduria cblC type, with homocystinuria Gene [Source:MGI (curated);Acc:Mmachc-001]

 
Come back to gene ENSMUSG00000028690


For any suggestions or comments, please send an email to unitrap@crg.es